>gi|254212202|Glomus claroideum strain DAOM 235359 clone 1 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTTTGGATACAGGTTCACCAATTAAAATCCCCGTGGGTCCTGAATGTTTAGGACGCATCATCAATGTTATCGGAGAACC
AATCGATGAACGTGGTCCAATTAACACAAAAAAAACTGCTGCTATTCATGCAGACGCACCAGAATTTGTTGATCAATCCA
CTGCTCCTGAAATTCTTGAAACTGGTATTAAGGTTGTGGATTTGTTGGCTCCTTATGCAAGAGGTGGCAAAATTGGATTG
TTTGGTGGCGCTGGCGTAGGAAAAACTGTGTTGATTCAGGAGTTGATCAATAACATTGCAAAAGCTCATGGTGGTTACTC
GGTGTTTTGTGGTGTTGGCGAGAGAACGCGCGAGGGAAACGATTTGTACCATGAAATGATTCAAACCGGCGTGATAAAAC
TTGATGGTGAATCAAAAGCTGCACTTGTCTTCGGTCAAATGAACGAACCACCAGGTGCTAGAGCTCGTGTTGCTTTAACT
GGTGTCACTATTGCTGAATATTTCCGTGATGATGAAGGTCAAGATGTGCTACTTTTTGTTGATAACATTTTCCGATTCAC
TCAAGCTGGTTCAGAAGTGTCTGCTTTGTTGGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212200|Glomus claroideum strain DAOM 235359 clone 2 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTTTGGATACAGGTTCACCAATTAAAATTCCTGTAGGACCTGAATGTTTAGGACGTATCATTAATGTAATTGGAGAACC
AATTGATGAACGAGGTCCAATTAACACAAAAAAAACTGCTGCTATTCATGCAGATGCACCAGAATTTGTAGATCAATCTA
CAGCTCCTGAAATTCTTGAAACTGGTATTAAAGTTGTAGATTTGTTGGCCCCTTATGCTAGAGGTGGTAAAATTGGTTTG
TTTGGCGGTGCTGGTGTAGGTAAAACTGTGTTGATTCAAGAGTTGATTAATAACATTGCAAAAGCTCATGGTGGTTATTC
AGTGTTTTGTGGTGTTGGTGAGAGAACACGTGAGGGAAATGATTTGTATCATGAAATGATACAAACTGGTGTAATTAAAC
TTGATGGTGAATCAAAAGCTGCATTAGTATTTGGTCAAATGAATGAACCACCAGGAGCTAGAGCTCGTGTTGCATTAACT
GGTGTCACTATTGCAGAATATTTCCGTGATGATGAGGGTCAAGATGTGTTACTTTTTGTTGATAACATTTTCCGATTCAC
TCAAGCCGGTTCAGAAGTATCTGCTTTGTTGGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212220|Glomus caledonium strain DAOM 234210 clone Nc F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTCGTGGATACTGGGGCACCAATTAGAATTCCTGTTGGTCCAGAATGTCTAGGACGTATTATTAATGTCATCGGTGAACC
TATCGATGAACGAGGCCCAATTAAAACAAAAAAGTTATCTCCAATTCACGCCGATGCACCAGAATTCATTGATCAATCTA
CAGTACCAGAAGTTCTTGAAACCGGTATTAAAGTTGTAGACTTATTAGCTCCTTACGCTAAAGGTGGTAAAATTGGTCTT
TTTGGAGGTGCTGGCGTTGGAAAAACTGTTTTGATTCAAGAACTTATCAACAATATTGCCAAAGCTCATGGTGGTTATTC
AGTATTTTGTGGAGTAGGAGAACGTACACGTGAAGGAAATGATTTGTATCACGAAATGATTCAAACAGGTGTAATTCAAC
TTGATGGTAAATCTAAGGCTGCTCTTGTATTCGGTCAAATGAATGAACCACCGGGTGCACGTGCTCGTGTCGCTTTAACT
GGCCTTACCATTGCCGAATATTTCCGTGACGATGAAGGACAAGATGTATTGCTTTTTATTGATAATATTTTCCGTTTCAC
GCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTGGGTTATCAA
>gi|254212222|Glomus multiforum strain DAOM 240256 clone Nc F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTCGTGGATACTGGGGCACCAATTAGAATTCCTGTTGGTCCAGAATGTCTAGGACGTATTATTAATGTCATCGGTGAACC
TATCGATGAACGAGGCCCAATTAAAACAAAAAAGTTATCTCCAATTCACGCCGATGCACCAGAATTCATTGATCAATCTA
CAGTACCAGAAGTTCTTGAAACCGGTATTAAAGTTGTAGACTTATTAGCTCCTTACGCTAAAGGTGGTAAAATTGGTCTT
TTTGGAGGTGCTGGCGTTGGAAAAACTGTTTTGATTCAAGAACTTATCAACAATATTGCCAAAGCTCATGGTGGTTATTC
AGTATTTTGTGGAGTAGGAGAACGTACACGTGAAGGAAATGATTTGTATCACGAAATGATTCAAACAGGTGTAATTCAAC
TTGATGGTAAATCTAAGGCTGCTCTTGTATTCGGTCAAATGAATGAACCACCGGGTGCACGTGCTCGTGTCGCTTTAACT
GGCCTTACCATTGCCGAATATTTCCGTGACGATGAAGGACAAGATGTATTGCTTTTTATTGATAATATTTTCCGTTTCAC
GCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTGGGTTATCAA
>gi|254212216|Glomus caledonium strain DAOM 234210 clone N4 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATCCCTGTTGGTCCTGAATGTTTAGGACGTATTATAAATGTCATCGGTGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAAACTTCCCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCCCTAGTCCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTCGGCGGTGCTGGTGTTGGAAAGACTGTATTGATTCAAGAACTTATCAACAACATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACGGGTGTAATTCAAC
TTGAGGGTCAATCTAAGGCTGCCCTCGTATTCGGCCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACCATTGCCGAATACTTCCGTGACGAAGAAGGACAAGACGTATTGCTTTTTATTGATAATATTTTCCGTTTCAC
TCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212208|Glomus cerebriforme strain DAOM 227022 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTCGTGGATACGGGTTCACCTATCAAAATTCCTGTTGGTCCTGAATGTTTGGGACGTATTATTAATGTTATCGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAGTTAGCCGCAATTCACGCAGATGCACCAGCATTCGTTGATCAATCTA
CAACGCCAGAAGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTTGGCGGTGCCGGTGTCGGAAAAACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCTCATGGTGGTTATTC
AGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACGGGTGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTTGTATTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTTGCTTTAACT
GGTCTTACTATTGCTGAATATTTCCGTGACGAAGAGGGACAAGATGTATTGCTTTTTATTGATAATATTTTCCGTTTCAC
TCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212204|Glomus custos strain DAOM 236361 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTTTAGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAATTGGCCCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCGGAGGTACTTGAAACCGGTATTAAAGTTGTAGATTTGTTAGCTCCTTATGCTAAAGGTGGCAAAATCGGTCTT
TTCGGCGGAGCTGGCGTTGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
TGTATTTTGTGGAGTAGGAGAACGTACCCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGTGTAATTCAAC
TTGAGGGTAAATCTAAGGCCGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATATTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCGGAAGTATCTGCTTTATTAGGTCGTATTCCTTCTGCTGTAGGTTACCAA
>gi|254212212|Glomus mosseae strain DAOM 240162 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATCCCTGTTGGTCCTGAATGCTTAGGACGTATTATAAATGTCATCGGTGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAAACTTCCCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCCCTAGTCCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTCGGCGGTGCTGGTGTTGGAAAGACTGTATTGATTCAAGAACTTATCAACAACATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACGGGTGTAATTCAAC
TTGAGGGTCAATCTAAGGCTGCCCTCGTATTCGGCCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGACGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
TCAAGCTGGTTCCGAAGTATCTGCATTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212210|Glomus clarum strain DAOM 234281 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATCCCTGTTGGTCCTGAATGCTTAGGACGTATTATAAATGTCATCGGTGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAAACTTCCCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCCCTAGTCCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTCGGCGGTGCTGGTGTTGGAAAGACTGTATTGATTCAAGAACTTATCAACAACATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACGGGTGTAATTCAAC
TTGAGGGTCAATCTAAGGCTGCCCTCGTATTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGACGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
TCAAGCTGGTTCCGAAGTATCTGCATTATTAGGTCGTATTCCTTCCGCTGTAGGTTACCAA
>gi|254212218|Glomus multiforum strain DAOM 240256 clone N4 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATCCCTGTTGGTCCTGAATGCTTAGGACGTATTATAAATGTCATCGGTGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAAACTTCCCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCCCTAGTCCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTCGGCGGTGCTGGTGTTGGAAAGACTGTATTGATTCAAGAACTTATCAACAACATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACGGGTGTAATTCAAC
TTGAGGGTCAATCTAAGGCTGCCCTCGTATTCGGCCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGACGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
TCAAGCTGGTTCCGAAGTATCTGCATTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212206|Glomus sp. DAOM 212150 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATCGATGAACGAGGTCCAATTAAGACCAAAAAATTATCACCAATTCACGCCGATGCACCAGAATTCATCGATCAATCTA
CAGTGCCAGAGGTACTTGAAACTGGTATTAAAGTTGTAGATTTGTTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTTGGCGGTGCCGGAGTCGGAAAGACCGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
AGTATTTTGTGGGGTAGGAGAACGTACCCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAAGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGATGAAGAAGGACAAGATGTATTGCTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCAGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212196|Glomus diaphanum strain DAOM 229456 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCTAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCCAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAGGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212214|Glomus aggregatum strain DAOM 240163 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCTAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAGGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|262527457|Glomus irregulare strain DAOM 240477 mitochondrial F-ATPase beta subunit (atp2) gene, partial cds; nuclear gene for mitochondrial product.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212184|Glomus irregulare strain DAOM 240201 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212186|Glomus irregulare strain DAOM 197198 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212188|Glomus irregulare strain DAOM 234181 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212192|Glomus irregulare strain DAOM 234180 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212194|Glomus irregulare strain DAOM 229457 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212190|Glomus irregulare strain DAOM 240159 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATCAATGTCATTGGTGAACC
TATTGATGAACGAGGTCCAATTAAAACCAAAAAATTATCTCCAATTCACGCCGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCATTGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTGGCTCCTTATGCTAAAGGCGGTAAAATCGGTCTT
TTCGGCGGTGCCGGCGTCGGAAAGACTGTATTGATTCAAGAACTTATCAATAATATTGCCAAAGCCCATGGTGGTTATTC
GGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTGTATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTTACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAAGTATCTGCTTTATTAGGTCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254212198|Glomus proliferum strain DAOM 226389 F-ATPase beta subunit (atp2) gene, partial cds; mitochondrial.
GTTGTGGATACAGGTTCACCAATCAAAATTCCTGTTGGTCCTGAATGTTTGGGACGTATTATTAATGTCATCGGCGAACC
TATTGATGAACGAGGTCCAATTAAGACCAAAAAATCATACCCAATTCACGCCGAAGCACCAGAATTCGTCGATCAATCTA
CAGTGCCAGAGGTTCTTGAAACTGGCATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTCGGCGGTGCCGGTGTCGGAAAGACTGTATTGATTCAAGAACTCATCAATAATATTGCCAAAGCTCATGGTGGTTATTC
AGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAACGATTTATATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTCACTATTGCCGAATACTTCCGTGACGAAGAAGGACAAGATGTATTACTTTTTATTGATAATATTTTCCGGTTCAC
CCAAGCTGGTTCCGAAGTATCTGCATTATTAGGCCGTATTCCTTCCGCTGTAGGTTATCAA
>gi|254733407|Glomus intraradices strain DAOM 225240 mitochondrial F-ATPase beta subunit (atp2) gene, partial cds; nuclear gene for mitochondrial product.
GTTGTGGATACAGGTTCACCAATAAAAATTCCTGTTGGTCCTGAATGTTTAGGACGTATTATTAATGTCATCGGCGAACC
TATTGATGAACGAGGCCCAATTAAGACCAAAAAATTATCCCCAATTCACGCAGATGCACCAGAATTCGTTGATCAATCTA
CAGTGCCAGAGGTTCTTGAAACTGGTATTAAAGTTGTAGATTTATTAGCTCCTTATGCTAAAGGTGGTAAAATCGGTCTT
TTTGGCGGTGCTGGTGTCGGAAAGACTGTATTGATTCAAGAACTCATCAATAATATCGCTAAAGCCCATGGTGGATATTC
AGTATTTTGTGGAGTAGGAGAACGTACTCGTGAAGGCAATGATTTATATCATGAAATGATTCAAACAGGCGTAATTCAAC
TTGAGGGTAAATCTAAGGCTGCTCTCGTGTTCGGTCAAATGAATGAACCACCAGGTGCACGTGCTCGTGTCGCTTTAACT
GGTCTCACTATTGCCGAATACTTCCGTGACGACGAAGGACAAGATGTATTACTTTTTATCGATAATATTTTCCGTTTCAC
CCAAGCTGGTTCCGAGGTATCTGCATTATTAGGTCGTATTCCTTCCGCTGTGGGTTATCAA