>gi|529509|Plasmodium yoelii yoelii dihydrofolate reductase (DHFR) gene, partial cds.
GCAATTTGTGCATGTTGTAAAGTTATAAACAATAATGAAAAGAGTGGAAGCTTTAACAATAAAACATTTAATGGACTTGG
AAATGCAGGGATGTTGCCTTGGAAATATAATTTAGTTGATATGAATTATTTTAGTTCTGTAACATCGTATGTAAATGAAA
ATAACTATATAAGATTGCAATGGAAGAGAGATAAATATATGGGGAAAAATAATTTAAAAAATAATGCAGAACTGAATAAT
GGCGAGCTGAATAATGGCGAGCTGAATAATAATCTGCAAAATGTTGTAGTGATGGGAAAAAGAAGTTGGGATAGTATCCC
CCCCAAATTTAAACCCTTACAAAATCGAATAAACATAATTTTGTCTAGAACTTTGAAAAAAGAAGATATTGCAAATGAGG
ATAACAAAAATAATGAGAACGGCACCGTTATGATAATTAAAAGCGTAGACGATTTGTTTCCTATCTTAAAAGCTATAAAA
TATTACAAATGTTTTATTATAGGGGGGTCATATGTTTATAAAGAATTTTTAGATCGTAATTTAATAAAAAAAATATATTT
TACAAGAATAAATAATTCATATAAT
>gi|529511|Plasmodium yoelii dihydrofolate reductase (DHFR) gene, partial cds.
GCAATTTGTGCATGTTGTAAAGTTATAAACAATAATGAAAAGAGTGGAAGCTTTAACAATAAAACATTTAATGGACTTGG
AAATGCAGGGATGTTGCCTTGGAAATATAATTTAGTTGATATGAATTATTTTAGTTCTGTAACATCGTATGTAAATGAAA
ATAACTATATAAGATTGCAATGGAAGAGAGATAAATATATGGGGAAAAATAATTTAAAAAATAATGCAGAACTGAATAAT
GGCGAGCTGAATAATAATCTGCAAAATGTTGTAGTGATGGGAAAAAGAAATTGGGATAGTATCCCCCCCAAATTTAAACC
CTTACAAAATCGAATAAACATAATTTTGTCTAGAACTTTGAAAAAAGAAGATATTGCAAATGAGGATAACAAAAATAATG
AGAACGGCACCGTTATGATAATTAAAAGCGTAGACGATTTGTTTCCTATCTTAAAAGCTATAAAATATTACAAATGTTTT
ATTATAGGGGGGTCATATGTTTATAAAGAATTTTTAGATCGTAATTTAATAAAAAAAATATATTTTACAAGAATAAATAA
TTCATATAAT
>gi|529507|Plasmodium vinckei dihydrofolate reductase (DHFR) gene, partial cds.
GCAATTTGCGCATGTTGTAAAGTTCTGAACAGTAATGAAAAGGCTAGCTGCTTTAGTAATAAAACTTTTAAGGGACTTGG
GAATGCAGGGGGATTACCTTGGAAATGTAATTCAGTAGATATGAAACATTTTGTTTCTGTTACATCATATGTTAATGAGA
ATAACTATATAAGATTAAAATGGAAAAGAGATAAATATATAAAAGAAAATAATGTAAAAGTAAATACTGATGGAATACCC
TCCATTGATAAGTTACAAAATATTGTAGTGATGGGAAAAACAAGCTGGGAAAGTATCCCATCAAAATTTAAACCATTAGA
AAATAGAATAAATATTATTTTATCTAGAACTTTGAAAAAAGAAAATCTTGCAAAAGAATATAGTAATGTTATTATAATTA
AAAGTGTAGATGAGTTATTTCCTATCTTAAAATGTATAAAATATTATAAATGTTTTATTATTGGGGGGGCATCTGTTTAT
AAAGAATTTTTAGATCGAAATTTAATAAAAAAAATATATTTTACAAGAATAAATAATGCTTATACT
>gi|529505|Plasmodium chabaudi dihydrofolate reductase (DHFR) gene, partial cds.
GCAATTTGTGCATGTTGTAAAGTTCTGAACAGTAATGAAAAGGCTAGCTGTTTTAGTAATAAGACTTTTAAGGGACTTGG
GAATGAAGGGGGGTTACCTTGGAAATGTAATTCAGTAGATATGAAACATTTTAGTTCTGTAACATCCTATGTTAATGAAA
CTAACTATATGAGATTAAAATGGAAAAGGGATAGATATATGGAAAAAAATAATGTAAAATTAAATACTGATGGAATACCC
TCCGTTGATAAGTTACAAAATATTGTAGTAATGGGAAAAGCAAGTTGGGAAAGCATCCCCTCAAAATTTAAGCCATTACA
AAATCGAATAAATATTATATTGTCTAGAACATTGAAAAAAGAAGATCTTGCAAAAGAATATAATAATGTTATTATAATTA
ATAGTGTGGATGATTTATTTCCTATTTTAAAATCCATAAAATATTATAAATGTTTTGTTATAGGAGGTGCATCTGTTTAT
AAAGAATTTTTAGATCGTAATTTAATAAAAAAAATATATTTTACAAGAATAAATAATGCTTATACG
>gi|529503|Plasmodium berghei dihydrofolate reductase (DHFR) gene, partial cds.
GCAATATGTGCATGTTGTAAAGTTCTGAACGATGATGAAAAGGTTAGATGCTTTAATAATAAAACGTTTAAGGGAATTGG
AAATGCGGGGGTGTTACCTTGGAAATGTAATTTAATCGATATGAAATATTTTAGTTCTGTAACATCATATATAAATGAAA
ATAATTATATAAGATTGAAATGGAAAAGAGATAAATATATGGAAAAACATAATTTAAAAAATAATGTAGAACTAAATACT
AATATAATTTCTTCAACTAATAATTTACAAAATATTGTAGTAATGGGAAAAAAAAGTTGGGAAAGTATTCCCAAAAAATT
TAAACCTTTACAAAATCGAATAAACATTATTTTGTCTAGAACTTTGAAAAAAGAAGATATTGTAAACGAAAATAATAATG
AAAATAATAATGTTATTATAATTAAAAGTGTAGATGATTTATTTCCTATTTTAAAATGCACAAAATATTACAAATGTTTT
ATTATAGGGGGTTCGTCTGTTTATAAAGAATTTTTAGATCGTAATTTAATAAAAAAAATATATTTTACAAGAATAAATAA
TTCTTATAAT