>gi|1401286|Plasmodium vinckei SERA-1 gene, partial cds.
GTAGTAGATATTGTAATTATGATTATTGTAATAGATGGCAAGATAAAACTAGCTGTATATCTAATATAGATGTAGAAGAA
CAAGGAAATTGTTCCCTATGTTGGTTATTTGCATCTAAATTACATTTAGAAACTATTAGATGCATGAGAGGATTTGGTCA
TAATAGAGGTTCAGCACTTTATGTAGCTAATTGTTCCGAAAGAACAGCAGACAACGTTTGTGATGTGGGATCAAATCCAA
TAGAATTTTTAAAAATTTTAGAAAAAAATAAATTTTTACCTCTAGAATCGAATTTTCCATATGTATGGAAAAATGTCTCA
GATACATGCCCAAAACCAGCAAATAATTGGACAAACATATGGGGAAATACTAAATTATTATATAATAATATGTATGGAGA
ATTTATTCAACATAGAGGATTTATAGCATATAATAGTCGTTATTTTGCTAAAAATATGGATGTATTTATTGATATTGTTA
AAAGAGAAATACGTAATAAAGGATCTGTTATAGCTTATATTAAAACCCGAGATGTTATAGAATATGATTTTAACGGTAGA
TATATAAGTAACATTTGTGGTCATAGTCATCCTGACCATGCTGTAAATATTATTGGATATGGTAATTATATAAGTGATAA
AGGAGAAAAAAGAACTTACTGGTTAATAAGAAATAGTTGGGGTTATTATTGGGGTCATGAAGGTAATTTTAAAGTTGATG
CTTTAGGCCCAGATAATTGTTTTCATAATTTTATCCATACTGTTATGGTATTTAAAATTGATATGGAACCTGATCATGAT
GGAGATTTCACAGTTAATGGTCAATCCATTGAAGAAAATAACAAATCTTATTTCCCTCAACTCAGTTCAAACTTTTACCA
TAGTCTTTATTACAACAACTACGAAGGACCTGAAAGAAAAAGTGATGATGAAAATGACAAAGATTATGACAATGCAGATG
TTAGTGGTCAATCTGAAACTTCTAAAAATGATTCACAACCTCAATCTGGTAGTACCGCTACTATCTCAAACCCTGCAACA
ATTGAAAAAACTATCCAAATACTTCACGTATTAAAACATATAGAAAACTATAAAATATCAAAAGGATTTGTTAAATATGA
TAATCTAAATGACACTAAAAGCGATTACGCATGTGCAAGATCATCTTCAAACGATCCTAAAAAAATTAATGAATGTAAAC
AATTCTGTGAGGAAAATTGGGAGCGATGTAGAAATCATTATTCACCAGGATATTGCTTAACTACTTTATCAGGAAAAAGC
AACTGTCTTTTCTGTTATGTATAA