>gi|17221670|Plasmodium vinckei brucechwatti from Nigeria, circumsporozoite protein (CS) gene, partial cds.
ATGAAGAAGTGTACCATTTTAGTTGTGGCATCCCTTTTATTAGTTGATTCCCTACTTCCAGGATATGGACAAAATAAAAC
AGTCCAAGCCAAAAGGAACTTAAACGAGTTATGTTACAATGAGGAAACTGATAATAAATTGTATCAAATGCTTAACTTGA
AAAATGGAAAAATATCCAACCGAAATATAGTCAACAGATTACTTGCAGATAAACCTGAAGAGAAAAAGGAAGAAAAAAAA
GACGAGAACAAGGAAGAGAAAAAGGACGAGAAAAAAGATGCGAAAAAAGAGCCTCATAATAAATTGAAACAGCAACCAGA
AGGCGGAGCACAAGGAGTTGCTGCAGGAGGGCAAGGAGCTGATGCAGGAGGGCAAGGAGTTGCTGCAGGAGGGCAAGGAG
TTGCTGCAGGAGGGCAAGGAGCTGATGCAGGAGGACAAGGAGCTGATGCAGGAAGACAGGGTGTTGATGCAGGAGGGCAA
GGAGCTGATGCAGGAAGACAGGGTGTTGATGCAGGAGGGCAAGGAGCTGATGCAGGAAGACAGGGTGTTGATGCAGGAGG
GCAAGGAGCTGATGCAGGAGGGCAAGGAGCTGATGCAGGAAGACAGGGTGTTGATGCAGGAGGGCAAGGAGCTGATGCAG
GAAGACAGGGTGTTGATGCAGGAGGGCAAGGAGCTGATGCAGGAGGGCAAGGAGCTGATGCAGGAAGACAAGGGGCTGAT
GCAGGAAGACAAGGGGCTGATGCAGGAAGACAAGGAGCTGATGCAGGAAGACAAGGGGCTGATGCAGGAAGACAAGGAGG
TGATGCAGGAAGGCAAGGTAATAATAACCAACCAAGAGATAGACCAGCAGAACCACAAGGTAATAATAACCAACCAAGAG
ATAGACCAGCAGCACCACAAGGTAATAATAACCAACCAAGAGATAGACCAGCAGCACCACAAGGTAATAACAATAACCAA
GGAGGAGGCAATAACAACAACAATAATAACAATAATAATAATGAAGCACCTGCGATGCCAACTGTGGAACAAATAAATGA
CTTCATTAATCAGATCAAAACTCAATTAACAGAGGAATGGTCTCAATGTAGTGTAACATGTGGTACTGGTGTAAGAATTA
GAAAACGAGCGGGTGTAAATAAGCAACCAGAAAATTATACCTTAGAGGATGTTGAAACTGAAGTTTGTAAAATGGATAAA
TGTTCAAGTATATTTAATATTGTAAGCAACTCATTAGGATTTGTAATATTATTAGTATTAGTATTCTTTAAT
>gi|17221668|Plasmodium vinckei vinckei circumsporozoite protein (CS) gene, complete cds.
ATGAAGAAGTGTACCATTTTAGTTGTAGCATCCCTTTTGTTAGTTGATTCCTTACTTCCAGGATATGATCAAAATAAAAA
TGTCCAAACCAAAAGAAACTTAAACGAGTTATGTTACAATGAGGAAACCGATAATAAATTGTATCAAATGCTTAACTCAA
AAAATGGAAAAATATCCAACCGAAATATAGTCAACAGATTACTTGCAGCTAAACCCGAAGAAAAAAAGGAAGAAAAAAAA
GAAGAAAAAAAAGAAGAGAAAAAAGAAGAGAAAAAGGAAGAGAAAAAGGAAGAGAAAAAAGATGAGAAAAAGGAAGAGAA
AAAAGCGCCTGAGAATAAATTGAAACAGCAACCAGAAGAAGGACAAGGAGGTAACGTAGTGCCAGGAGGTGGAGGAGTAG
ACGTACCAGGAGCAGGAGCAGGAGCAGGAGCAGGTGCAGGAGCAGGTGCAGGAGCAGGAGCAGGAGCAGGTGCAGGAGCA
GGTGCAGGAGCAGGACAAGGAGGTGATGCAGCAGAACAAAGAGGAGGAGGAGGAGGACAAGAAGGTGATGCAGCAGAACA
AAGAGGAGGAGGAGGACAAGGAGGTGATGCAGCAGAACAAAGAGGAGGAGGAGGAGGACAAGAAGGTGATGCAGCAGAAC
AAAGAGGAGGAGGAGGAGGAGGACAAGGAGGTGATGCAGCAGAACAAAGAGGAGGAGGAGGACAAGAAGGTGATGCAGCA
GAACAAAGAGGAGGAGGAGGAGGACAAGGAGGTGATGCAGCAGTACCAGCAGATAGACCAGCAGCACCAGCAGATAGACC
TGCAGCACCAGCAGATAGACCAGCACCACCAGCAGATAGACCAGCACCACCAGCAGATAGACCAGCACCACCAGCAGATA
GACCAGCAGGAGGTGGTGGTAATAACAACAACCCAAGAGGCCAGGGAAATCAACCAGCAGGAGGTGGTAATAACAATAAC
CCAGGAAGAGGTAATAACAACAACAATAATAATAATAATAATAATGAAGCGCCTGCGATGCCAACTGTGGAGCAAATAAA
TGAGTTCATTAATAAGGTCAAAAATGAATTAACAGACGAGTGGTCTCAATGTAGTGTAACATGTGGTACTGGTATAAGAA
TTAGAAAACGACCAAATCTAAATAAGCAACCAGAAAATTATACCATAGATGATTTTGAAACTGAAGTTTGTAAAATGGAT
AAATGTTCAAGTATATTTAATATTGTAAGCAACTCATTAGGATTTGTAATATTATTAGTATTAGTATTCTTTAATTAA
>gi|17221664|Plasmodium vinckei lentum circumsporozoite protein (CS) gene, complete cds.
ATGAAGAAGTGTACCATTTTAGTTGTAGCATCCCTTTTATTAGTTGATTCCCTACTTCCAGGATATGGACAAAATAAAAA
TGTCCAAGCCAAAAGGAACTTAAACGAGTTATGTTACAATGAGGAAACTGATAATAAATTGTATCAAATGCTTAACTTAA
AAAATGGAAAAATATCCAACCGAAATATAGTCAACAGATTACTTGACGATGAATCCGAAGAAGATGACGACGAGGATGAA
GACGAAGAAAAGAAAGATGAGAAAAAAGATGAGAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGAGAAAAAAGATGT
GAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGTGAAAAAGGATGAGAAAAAAGATGTGAAAAAAGATGTGAAAAAAG
TGCCTCACTATAAATTGAAACAGCCACAAGAAGGAGATCAACGACCAGCAGCAGCAGTAGATGGAGGAGGACAAGGAGGT
GATGCAAATCCACAAGGAGGAGATGGTCGAGGAGCACAAGGCGGTGATGCAAATCCACAAGGAGGAGATGGTCGAGGAGC
ACAAGGGGGTGATGCAAATCCACAAGGAGGAGATGGTCGAGGAGCACAAGGGGGTGATGCAAATCCACAAGGAGGAGATG
GTCGAGGAGCACAAGGGGGTGATGCAAATCCACAAGGAGGAGATGGTCGAGGAGCACAAGGCGGTGATGCAAATCCACAA
GGAGGAGATGGTCGAGGAGCACAAGGCGGTGATGCAAATCCACAAGGAGGAGATGGTCGAGGAGCACAAGGCGGTGATGC
AAATCCACAAGGAGGAGATGGTCGAGGAGCACAAGGCGGTGATGCAAATCCACAAGGAGGTAGACCCGCACCGCCACAAG
GAAATGATGCAAATCCACAAGGCGGTAGACCAGCACCACCACAAGGGAATGATGCAAATCCACAAGGCGGTAGACCAGCA
CCACCACAAGGGAATGATGCAAATCCACAAGGCGGTAGACCAGCACCACCACAAGGGAATGATGCAAATCCACAAGGCGG
TAGACCAGCACCACCACAAGGTAATAACAATCAGCCAGGAGGTAGACCAGCACCGCCACAAGGTAATAACAATAATAATA
ATGAAGCTCCTGCGATGCCAACTGTGGAACAAATAAATGACTTCATTAATCAGGTCAAAGCTCAATTAACAGAGGAATGG
TCTCAATGTAGTGTAACATGTGGTACTGGTGTAAGAATTAGAAAACGAGCAGGTGTAAATAAGCGACCAGAAAATTATAC
CTTAGAGGATGTTGAAACTGAAGTTTGTAGAATGGATAAATGTTCAAGTATATTTAATATTGTAAGCAACTCATTAGGAT
TTGTAATATTATTAGTATTAGTATTCTTTAATTAA
>gi|17221666|Plasmodium vinckei petteri circumsporozoite protein (CS) gene, complete cds.
ATGAAGAAGTGTACCATTTTAGTTGTAGCATCCCTTTTATTAGTTGATTCCCTACTTCCAGGATATGGACAAAATAAAAA
TGTCCAAGCCAAAAGGAACTTAAACGAGTTATGTTACAATGAGGAAGCTGATAATAAATTGTATCAAATGCTTAACTTGA
AAAATGGAAAAATATCCAACCGAAATATAGTCAACAGATTACTTGACGATGAAGACGAAGAAGATGACGACGAGGATGAA
GACGAAGAAAAGAAAGATGTGAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGT
GAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGTGAAAAAAGATGCGAAAAAAGATGAGAAAAAAGATGTGAAAAAAG
TGCCTCACTATAAATTGAAACAGCCACAAGGAGATCAACGACCAGCAGCAGCAGCAGCAGCAGTAGTCGATGGAGGCGGA
GGAGGAGGAGGAGGAGGACAAGATCCACCAGTAGTCGATGGAGGCGGAGGCGGAGGAGGACAAGATCCACCAGTAGTCGA
TGGAGGCGGAGGAGGAGGAGGACAAGATCCACCAGTAGTCGATGGAGGCGGAGGCGGAGGAGGACAAGATCCACCAGTAG
TCGATGGAGGCGGAGGAGGAGGAGGACAAGATCCACCAGTAGTCGATGGAGGCGGAGGAGGAGGAGGACAAGATCCACCA
GTAGTCGATGGAGGCGGAGGAGGAGGAGGACAAGATCCACCAGTAGTCGATGGAGGCGGAGGAGGAGGAGGACAAGATCC
ACCAGTAGTAGATGGAGGAGGAGGAAGGGGAGGCCAAGATGCTCCAGGAGTAGTACCAGCAGCACCACGAGGTAATAACA
ATCCACAAGGTAATAACAATCCACAAGGTAACAACAATCCACAAGGTAATAACAATCCACAAGGTAATAACAATCCACGA
GGTAATAACAACCCAGGAAATCAACCAAGGCCAGCCCCAGGTGGTGGTGATAATAACAACAACCAGCCAGGAAGAGATAA
TAACAATAATAATAATGAAGCGCCCGCAATGCCAACTGTGGAACAAATAAATGACTTCATTAATCAGGTCAAAGCTCAAT
TAACAGAGGAATGGTCTCAATGTAGTGTAACATGTGGTACTGGTGTAAGAATTAGAAAACGAGCAGGTGTAAATAAGCGA
CCAGAAAATTATACCTTAGAGGATGTTGAAACTGAAGTTTGTAGAATGGATAAATGTTCAAGTATATTTAATATTGTAAG
CAACTCATTAGGATTTGTAATATTATTAGTATTAGTATTCTTTAATTAA
>gi|17221672|Plasmodium vinckei circumsporozoite protein (CS) gene, partial cds.
ATGAAGAAGTGTACCATTTTAGTTGTAGCATCCCTTTTATTAGTTGATTCCCTATTTCCAGGATATGGACAAAATAAAAA
TGTCCAAGCCAAAAGGACCTTAAACGAGTTATGCTACAATGAGGAAGCTGATAATAAATTGTATCAAATGCTTAACTTGA
AAAATGGAAAAATATCCAACCGAAATATAGTCAACAGATTACTTGACGATGAATCCGAAGAAGATGACGACGAGGATGAA
GACGAAGAAAAGAAAGATGAGAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGA
GAAAAAAGATGTGAAAAAAGATGTAAAAAAAGATGAGAAAAAAGATGTGAAAAAAGATGCGAAAAAAGATGTGAAAAAAG
ATGTGAAAAAAGTGCCTCACTATAAATTGAAACAGCAACCAGAAGGAGGAGACCAACCAGCTGCTGCCGTTGCAGGAGGT
GGAGGAAATCAAGACCAACCAGCCGCTGCCGTTGCAGGAGGTGGAGGAAATCAAGACCAACCAGCTGCTGCCGTTGCAGG
AGGTGGAGGAAATCAAGACCAACCAGCTGCTGCCGTTGCAGGAGGTGGAGGAAATCAAGACCAACCAGCCGCTGCCGTTG
CAGGAGGTGGAGGAAATCAAGACCAACCAGCCGCTGCCGATGCAGGAGGTGGAGGAAATCAAGACCAGCCAGCAGCTGCC
GATGCAGGAGGTGGAGGAAATCAAGACCAGCCAGCAGCTGCCGATGCAGGAGGTGGAGGAAATCAAGGCAGACGAGCAGT
ACCACAAGGAGACAGACCAGCACAACCGGAAGTACCACAAGGAGACAGGCCAGCACAACCGGCAGTACCACAAGGAGACA
GGCCAGCACAACCGGCAGTACCACAAGGAGGCAGACCAGCACAACCGGCAGTACCACAAGGGAATAACAACCAAGGAAGA
GGACAAGGAAATCAGCCAGCAGGAGGTGGTGGTAATAACAACAACCAGCCAGGAAGAGGTAATAACAACAACAATAATAA
TAATGAAGCTCCTGCGATGCCAACTGTGGAACAAATAAATGACTTCATTAATCAGGTCAAAGCTCAATTAACAGAGGAAT
GGTCTCAATGTAGTGTAACATGTGGTACTGGTGTAAGAATTAGAAAACGAGCAGGTGTAAATAAGCAACCAGAAAATTAT
ACCTTAGAGGATGTTGAAACTGAAGTTTGTAGAATGGATAAATGTTCAAGTATATTTAATATTGTAAGCAACTCATTAGG
ATTTGTAATATTATTAGTATTAGTATTCTTTAATAA