>gi|157887510|Plasmodiophora brassicae partial ORF1 and ORF2 DNA for hypothetical proteins, clone PbL7a/PbCHAP.
GGCACATTGCAGGACATGCAGCTCCTGGCTTTGCTCGTCCAGTGCAACCTCAGCACCGCACTGTGGGCACAAGGACCCGA
AATCGTGTCGATACCGACAATGCGATGCATAGCGGCAGGTGCGCTGCAGGAAAAACGGGCAGACCTTTGTGGAAGGCGAC
GGGCCTGATGTCGGGTACATCACGTCTGACCTTGCAACGGGGGACGCGGGTAATCCAATGCCGACCAGTTTCGAGGCGTA
CGAATCAGCATGCGGGCCGTTATCAGATACGATCGGTCTGTCGATACGAAAGTAAGTAAATGAATCAGATCAACAACAGC
GGCGACTCGTCCAGTCCATGCAACTGGACCGACAAGAACGCAAACATTAAAAACAGAAATCGAGCATACTTGAGCAGTGT
GGACCCCATGTAAACCTGGTCAGAGGGATCTGTGCATTTGGATTCAACCGGTTCCAGGAGCGAGTCTATGCGAAGGGCAT
GCTCGATATCGGCCTGCGGGTGATCGTCATCATCCTCGTCCTCGGACGCATTACGATAGGCAGCATTTTCTGATCGCGAT
CGTTGCAGGAAATCATTCGCCGACGACGTTGGACTGGAGAATGCCCCAGGAGCGCCAAAGAAGTATGACGAATCATGCAT
GAAAAATGAGGTTGGTGTGGGCGGTCCAGCGCCGCCCCAGGTCGAGTTCGCCGCAGGACTCCCGCCTCGTACGGGCGACT
CCGAGGCCGCCCGCGGCCAGTACAGCGTCGGGCGCGCTGATGACGACATGACAGTGCGCCTGCGGACCGAAACGGAACGT
TCAACGTTGGACTTCAAATGCAGACTGCGGTGCGCGGGCGGTTGCGGCGCGGCGCGGCCTCCGCCGGCACGGCTCTCTGC
TCCTCTGTTGGCTATATCGTAGGACCGGCGACCGTAGCGCCTAGCGGACCACAAACACGCCCGGCCACAAACCGAGCATG
CCACGGTACAGTCCCGTTCTGCCTGTACATGAAGTCCACTAAGCAACACGAAACCCAATGGGCGTCTCTTGGGCGCCGCA
GGTCGCTGACACTCCTGTCCCGTGGTAACTACGACGTTGGACTTGAGGGGTCCGAGTGAGCAGGGCAGTGGATGAACAGG
CGACAGCTTGTTGCCCAATGACGTACTGCGCAGTGGAATAAACCAAATCACAAGGTGACCCACATTCCATTTTGTTGTAC
CTACCTAGTGAACCATTTCTGTAGCTTTATTCAAATTTTTGAGAATTTCTGTAAATATTAGGCACGATTTCGGGTACGAA
TGGCTGAATGGCAGATAATTGGCAATGAAGAGCAGCATTCCTCAGTCAACCAGAACTGGCCGCAGCAGTTCGGAAGTTTT
AGGGCGCCCGACCGTATATGGAAGTCCGTGCGGTGTCCGTGCTGGTCCGGTGTTGCAGCCAGAGCGATCATGTCGAAAGC
AACGGGTGCCAAGAAGGCCGGCGGTGCCAAGGCGCCTGTGAAGAAGACGTCGGCGAAGTCCAAGTTCCACGAGGAACACG
CCCACTTGTTCCAGGCTCGGCCGCGCAACTATGGCATTGGTCGCGAAAACGTTCCCGGACGTGATCTGGGACGTTATGTG
AAGTGGCCGCGGTACATCCGCATTCAGCGCCAGCGCGCCATCCTCAAGCAGCGTCTCAAGGCGCCTCCGTCGGTGAACCA
CTTCACCAACACGCTGGAGAAGGCGCAGTCGACGACCCTGTTCAAGCTGCTGTCCAAGTACCGCCCGGAAACTCGCCCGG
AGAAGAAGCTCCGACTGCGCGCTGTTGCTGAGAAGGTATTGCAATTGTGTTTGAGCCTATAAACGGAGCGCTAACATGGT
CGACAGCTTGCTGCAGGTGAGACGACGACCACGGAAGCCAAGAAGCCGAAGTTCGTCAAATTCGGCCTTAACCATGTCAC
GAGCCTCATCGAGAAGGGCAAGGCGAAGATGGTTGTCATCGCGCACGACGTTGACCCGCTCGAGCTGGTTCTGTGGCTTC
CTGCTCTTTGCCGCGCGAAGAACGTCCCCTACTGCATTGTCAAGGGCAAGGCACGTCTTGGCATGATTGTCCATCAGAAG
ACTGCTGCTGTTCTCGCTATCACCGATGTCCGCAAGGAGGACCAGGCTACGTTCGATCAGCTCAACAAGGCGTTCCTTGA
GAAGTTCAACAACAACACGGACTCGTTCCGCAAGTGGGGCCGTCACAAGCTTGGCACAAAGGCAACCGCCAAGGTCAACA
AGCTGGAACGTACGTTTTCTCTGTCGTCGCGTGTGTCTCACGAAGACCTAACGTTGTGTCTAGGCGAGAAATCGAAGGAG
ATGGCTGCTCTGCAGTCGCAGTAAGCAGGCAATATGCGTCGTTGCATATGGTGCAGAATAAATGCCAACAATCACCACAG
AATGCGCCCGTTTGGAGTGCGTAGTGAGGGCAGTTGGCGCTCTTGAAGCCTGCAATGTGCGGTGTCGCCGGTCTACTGTT
CATTTGCTCGTTGGCTTTCTACTATTTTATGTCAACTGTGTTGTTTCTTAGTTGAGGTACGTTTATCAATGTCGGTTGTT
TGAATGCGAGTGCGCCCGGTCGCCGTCCAGTGTCCTCAATACAGTGCTCTTGCGATTCTCTTATGGTGGTCAGTTGTCCG
CCTGGCAAGGACGAATGACGCGCAGCCGAGTACCTAACATGGGAGTCGGAGAGCTCCGTAACCAGTGATCTGGATCGCGG
GCCCATTTTGTGTACCTACGAAGTGTGATCGGTCGTTTAGTCAGGCGGGGTAAAGCGCGGCAGATGTTCGCTGTGGCCGT
GCTTCGGGTGGCAGTTGCGACCGTCGTCCTGCAGGGGCAACGATCCTTGTCAAGTTCGGCGGCGCCATTCGGGACGATTC
TCGGGGAGACTTGGGGCGGCGTGCAAGTCTACGGTTGCGATTCCGCCACAGCGAATTCGACGTGGATGCAGAACTACGTT
AATGGCGTCTTCACAGGCATCAAGTGGCAGTGCGTCGAGCTCGCTAGACGGTATCTTCTCCTGAACCACGGCGTCGTCTT
CGACTCGATCCCGATGGCCTACGACATCTACGACTTGAAGGATGTGGTTCGCGTTGGCGACCAGTATCGAGAGCCGCTGG
TCGCGTATGCGAATGGGTCAACGACTGTCCCGGAGAGGGGAACGTTGCTAGTATGGGCGGCGGGCGGTTACTATGCCAAG
ACCGGCCACGTCGCCGTTGTTGTTGACGTGCATGACGGGTACCTCGACATTGTCGAACAGAATGTCGAGGACACCATCTG
GCCACCCGGCAGAGCATATTCTCGCCGCCTGCGAACATCGCGCGATGAACGAACCGGTTCGTTCATCGTGCACGACACAT
TTGCCGATGTGGCGCTTCTCGGATGGATGATGGTCGATGGCTCCTCTAAGCCTATCGTCGCCGAATTATAAACGTCAAGA
GAACGTCGTTGCCTAACCATTCCGTCGCCTGTAGTCGTTGAGCCGGGGCAGGTATTGTTATATACGCAGCGGGGACATTA
GGTCTCGGGTCGTTCGCCTTCGTTGTTGTTGACCAGGCATTGTACCAACTGACGTTCGACCCAGGCCGCTATGAACGTAT
CGGTGCTCGGCAGATTGTAACTCAGCATGACGCGACGTCCCGTCTTTATGGCTACAGCATTCAGAGTCAGAAGAGCCGCG
GCAAACCGGTCGTGCGTTTGGCAAATTCAACGAACCGAGACGACGGCATAACGACGATCGTTCCAGGTTGTCGTCGCCGT
TTGATACGAGCTGTGTATGTGCAGGCACATCCGACTATGCCACTTGTCAGCAGGCTTTAGGTATGGGATTGCGTCGGGAA
TATCCTACGTAGGGCGTCCTCGTCGCCATCGACAAATCCTTCACGTCCCCTGGTTTCAGCCCGACGTATGCGTAGACGGT
GCGGCGCATCGTCACAATCTGGAACTGAACAGGCACCTGCCCCGACGCCGATTCATACACGGCATCTGTGGATCCGCACC