>gi|116222178|Thaumatomonas sp. TMT002 Hsp90 mRNA, partial cds.
CTCCAACAAGGAGATTTTCCTGCGAGAGCTCATCTCCAACGCATCCGATGCGCTGGACAAGATTCGCTACCTGTCTTTGA
CCGACAAGGGCCAACTCGCCACCGAGCCTGAGCTTCGCATTCAGATTGTCCCCGACAAAGACAATCACACCCTCACCATC
CAGGACACCGGCATCGGCATGACCAAGAACGACATGATCAACAACCTCGGCACCATCGCCAAGTCGGGCACCAAGGGCTT
CATGGAGGCCATTCAGGCTGGCGCTGATCTGTCCATGATCGGACAGTTTGGTGTCGGTTTTTACTCCGCATACCTAGTTG
CTGAACGTGTGGAGGTGCACTCCAAGCACAACGACGACGAGCAATACACGTGGATCTCCGAGGCTGGCTCTTCGTTCCAG
ATTCTCCCCGGCTCTGGCGAGCCACTGACCCGCGGAACCCGCATTGTCCTTCACCTCAAGAAGGATCAATTCGAGTACCT
CGAAGAGAAGAAACTCAAGGATCTCGTCAAGCGCCATTCCGAGTTCATCGGCTTCCCCATCTCGCTGCGAGTGACTAAGA
CGGAGGAGAAGGAGGTGGAGGAGGAGGAGGACAAGCCCGAGATGGATGACGATGACGACAAGCCCAAGATCGAGGAGGTG
GAAGATGATGAGGACAAGAAGAAAGGCAAGGGCAAGAAGAAGGAGAAGGTGACCACCAAGGAGTGGGAGCTGCTGAACAA
GCAAAAGCCCATCTGGACCCGCAAACCAGAGGAAGTGAAGAAGGAGGAGTACGCTGCCTTCTACAAGGCGCTCACCAACG
ACTGGGAGGAGCACTTGGCCGTGAAGCACTTTTCCGTTGAAGGTCAGCTCGAGTTCAAGGCTATTCTATTCGCTCCAAAA
CGCGCTCCGTTTGACCTCTTCGAGTCCAAGAAGAAGCAGAACAACATCAAGCTCTACGTGCGCCGCGTCTTCATCATGGA
CGACTGCAAGGACCTCATCCCCGAGTACCTGTCCTTCGTCAAGGGTGTCGTCGACTCCGAGGATCTCCCCCTCAACATCT
CTCGCGAGTCTCTCCAGCAGAACAAGATTCTTCGTGTCATCAAGAAGAACCTCGTCAAGAAGTCGCTCGAGTTGTTCAGC
GAAATCGCCGAGAACAAGGAGGACTACAAGAAGTTCTACGAGGCCTTCAGCAAGAACCTCAAGCTCGGCATCCACGAGGA
CTCCACCAACCGTCAAAAGTTGGCCGAGTTGCTCCGCTACAAGTCGTCCAAGTCTGGTGGGGAGTTGACTTCGCTCAAGG
AGTACGTGGAGCGCATGAAGGAGGGTCAGAAGTCC
>gi|116222180|Thaumatomonas sp. TMT002 Hsp90 mRNA, partial cds.
CTCCAACAAGGAGATTTTCCTGCGAGAGCTCATCTCCAACGCATCTGACGCGCTCGACAAGATCCGATACTTGTCTCTGA
CCGACAAGGGCCAGCTCGCAACGGAGCCAGAGCTGCGGATTCAGCTAATCCCTGACAAGGAGGCGCACACCCTCACGATT
CAGGACACCGGCATCGGCATGACGAAAAACGACATGATCAACAATCTCGGCACCATTGCCAAGTCAGGCACCAAGGGCTT
CATGGAGGCCATCAATGCTGGCGCTGACTTATCGACGATTGGACAATTTGGTGTTGGATTCTACTCATCATATTTAGTCG
CTACGCGTGTCGAGGTGCACTCCAAGCACAACAACGACGAGCAGTACACTTGGATTTCCGAGGCCGGCTCTTCCTTCCAG
ATCCTCCCCGGCTCTGGCGAGCCGATCACCCGCGGCACTCGCATCGTTCTCCACCTCAAGAAGGATCAGTACGAGTACTT
GGAGGACAAGAAGATCAAGGATCTCGTCAAGCGTCATTCTGAGTTCATCGGCTTCCCCATCTCGCTCCAAGTGACCAAGA
CAGAGGAAAAGGAGGTTGAGGAGGAAGAGGAGGACAAGCCTGATGATGACGACGATGACAAACCCAGGATTGAGGAGGTG
GAGGATGATGAAGACAAGAAGAAGGGCAAGGGCAAGAAGAAGGAGAAGGTGACCCGCAAGGAATGGGAGCTGCTCAACAA
GCAAAAGCCCATCTGGACCCGCAAGCCCGATGAAGTGAAAAAGGAGGAATATGCCAACTTCTACAAGGCTCTCACCAACG
ACTTTGAGGATCACTTGGCTGTCAAGCACTTCTCCGTCGAAGGTCAGCTCGAGTTCAAGGCCATTCTCTTTGCACCCAAG
CGCGCTCCGTTCGACCTCTTCGAGTCCAAGAAGAAGCAGAACAACATCAAGCTCTACGTGCGCCGCGTCTTCATCATGGA
CGACTGCAAGGACCTCATCCCCGAGTACCTGTCCTTCGTCAAGGGTGTCGTCGACTCCGAGGATCTCCCCCTCAACATCT
CTCGCGAGTCTCTCCAGCAGAACAAGATTCTTCGTGTCATCAAGAAGAACCTCGTCAAGAAGTCGCTCGAGTTGTTCAGC
GAAATCGCCGAGAACAAGGAGGACTACAAGAAGTTCTACGAGGCCTTCAGCAAGAACCTCAAGCTCGGCATCCACGAGGA
CTCCACCAACCGTCAAAAGTTGGCCGAGTTGCTCCGCTACAAGTCGTCCAAGTCTGGTGGGGAGTTGACTTCGCTCAAGG
AGTACGTGGAGCGCATGAAGGAGGGTCAGAAGTCC
>gi|116222176|Thaumatomonas sp. TMT002 Hsp90 mRNA, partial cds.
CTCCGAGTTCATTGGCTTCCCCATCTCTCTCCAAGTGACCATGACCGAGGAGAAGGAGGTTGAGGACGAGGAAGAGGACA
AGCCCGAGGACGAGGATGATGACAAGCCCAAGATCGAGGAGGTTGAGGATGACGAGGACAAGAAGAAGGGCAAGGGCAAG
AAAAAGGAGAAGGTGACCCGCAAGGAGTGGGAGCTCCTCAACAAGCAGAAGCCCATCTGGACCCGCAAGCCCGAGGAGGT
TCAGAAGGAGGAGTACGCTGCCTTCTACAAGGCTCTCACCAACGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCCG
TCGAGGGTCAGCTCGAGTTCAAGGCCATCCTCTTCGCCCCCAAGCGCGCTCCGTTCGACCTCTTCGAGTCCAAGAAGAAG
CAGAACAACATCAAGCTCTACGTTCGTCGCGTCTTCATCATGGACGACTGCAAGGACCTCATCCCCGAGTGGTTGTCCTT
CGTCAAGGGTGTCGTCGACTCTGAGGATCTGCCCCTCAACATCTCTCGTGAGTCTCTCCAGCAGAACAAGATTCTCCGCG
TCATCAAGAAGAACCTCGTCAAGAAGTCCCTCGAGCTGTTCGCCGAGATCGCCGAGAACAAGGAGGACTACAAGAAGTTC
TACGAGGCCTTCAGCAAGAACCTCAAGCTCGGCATCCACGAGGACTCCACCAACCGTCAAAAGTTGGCCGAGTTGCTCCG
CTACAAGTCGACCAAGTCCGGTGGCGAGCTCACCTCGTTCAAGGAGTACGTCGATCGCATGAAGGAGGGCCAGAAGTCCA
TCTTCTACATCACCGGCGAGTCCGACGCCGCGGCCGAGGCCTCTCCCTTCTTGGAGGCCCTCAAGAAGAAGGGCATCGAA
GTCCTGTACATGACCGACCCCATCGATGAGTACGCCGTCCAGCAGCTCAAGGAGTTCAACGACAAGAAGCTCGTGTCCGC
CACCAAGGAGGGCCTCGAGCTCGAGCTCACCGAGGACGAGAAGAAGTCCAAGGAGGAGGAGAAAGCCCAGTTCGAGGGTC
TGTGCAAGAAGGTCAAGGACGTGCTCGGCGAGAAGGTGGAGAAGGTCATCCTCTCCGACCGCATCGTCAACTCGCCTTGC
GTCTTGGTCACCGGCGAGTTC
>gi|31982985|Thaumatomonas sp. (SA) heat shock protein 90 (Hsp90) gene, partial cds.
GACGCTCTGGACAAGATACGCTACCTCTCCTTGACCGACAAGGGCCAGCTCGCCACCGAGCCCGGGCTCCGCATTCAGAT
CATCCCTGACAAGGACAACCACACCCTCACCATCCAAGACACTGGCATTGGCATGACCAAGAATGACATGATCAACAACT
TGGGCACCATCGCCAAGTCCGGAACCAAGGGTTTCATGGAGGCCATCCAGGCTGGCGCTGATTTGTCCATGATCGGTCAA
TTCGGTGTCGGTCTCTACTCGGCTTATCTCGTTGCTGAGCGTGTCGAGGTGCACTCCAAGCACAACGACGACGAGCAGTA
CACTTGGATCTCCGAGGCCGGCTCTTCCTTCCAGATTCTCCCCGCCTCCGGCGAGCAGATCACCCGCGGCACCCGCATCA
CCCTTCACCTCAAGAAGGACCAGTACGAGTACCTCGAGGAGAAGAAGCTCAAGGACCTTGGTAACACATGCACGCACACG
CACGCACACTTTCTTTCCTTGGCCGCCCCCCCCCCCCCCCCAAAAAAAACGAACTTTCCTGATCCGTGTCCTTTGCAGTC
AAGAAGCACTCCGAGTTCATTGGCTTCCCCATCTCTCTCCAAGTGACCAAGACCGAGGAGAAGGAGGTTGAGGACGAGGA
AGAGGACAAGCCCGAGGACGAGGATGATGACAAGCCCAAGATTGAGGAGGTTGAGGATGACGAGGACAAGAAGAAGAAGA
GCGGCAAGAAAAAGGAGAAGGTGACCCGCAAGGAGTGGGAGCTCCTCAACAAGCAGAAGCCCATCTGGTAACAACCCCTT
CCTCTCAGTCACCTCGCTCACTTCCCTCATCCCGCACACGAACTCACGTTTTTCCCTGTTAGGACCCGCAAGCCCGAGGA
GGTTCAGAAGGAGGAGTACGCCGCCTTCTACAAGGCTCTCACCAACGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCT
CCGTCGAGGGTCAGCTCGAGTTCAAGGCCATCCTCTTCGCCCCCAAGCGCGCTCCGTTCGACCTCTTCGAGTCCAAGAAG
AAGCAGAACAACATCAAGCTCTACGTGCGCCGCGTCTTCATCATGGACGACTGCAAGGACCTCATCCCCGAGTGGTTGTC
CTTCGTCAAGGGTGTCGTCGACTCTGAGGATCTGCCCCTCAACATCTCTCGTGAGTCTCTCCAGCAGAACAAGATTCTCC
GCGTCATCAAGAAGAACCTCGTCAAGAAGTCCCTCGAGCTGTTCGCTGAGATCGCCGAGAACAAGGAGGACTACAAGAAG
TTCTACGAGGCCTTCAGCAAGAACCTCAAGCTCGGCATCCACGAGGACTCCACCAACCGTCAAAAGTTGGCCGAGTTGCT
CCGCTACAAGTCGACCAAGTCCGGTGGCGAGCTCACCTCGTTCAAGGAGTACGTCGATCGCATGAAGGAGGGCCAGAAGT
CCATCTTCTACATCACCGGCGAGTCCGACGCCGCTGCCGAGGCTTCTCCCTTCTTGGAGGCCCTCAAGAAGAAGGGCTTC
GAAGTCTTGTACATGACCGACCCCATCGATGAGTACGCCGTCCAGCAGCTCAAGGAGTTCAACGACAAGAAGCTCGTGTC
CGCCACCAAGGAGGGCCTCGAGCTCGAGCTCACCGAGGACGAGAAGAAGGCCAAGGAGGAGGAGAAGGCCCAGTTCGAGG
GTCTGTGCAAGAAGGTCAAGGACGTGCTCGGCGAGAAGGTGGAGAAGGTCATCCTCTCCGACCGCATCGTCAACTCCCCT
TGCGTCTTGGTCACCGGCGAGTTCGGCTGGTCCGCCAACATGGAGCGCATCATGAAAGCCCAAGCTCTGAG