>gi|90186559|Plasmodium vinckei lentum strain 194ZZ cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGATTCCTATTAGGAATTATATTCTTTATTCAAATTTTAACAGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATATCTTATGCATATTATAGTATTCAACATATTCTAAGAGAATTATGGAGTGGATGGTGTTTTAGATATATGCATG
CTACTGGAGCATCTCTTGTATTTTTCTTAACTTATTTACACATCCTAAGAGGATTAAATTATTCATATTTATATTTACCT
TTATCATGGATATCAGGATTAATTATTTTTGCATTATTTATAGTTACTGCTTTTATTGGTTATGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCCACTGTTATAACTAATTTATTATCAGGTATTCCATCATTAGTCATTTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACAATAAAAAGATTTTTTGTTTTACATTTTATACTACCATTTGTTACTTTATGTATAGTATTT
ATACATATATTCTTCTTACATTTACACGGTAGCACTAATCCTTTAGGGTATGATACATCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCAGATAATGCAATAATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTTTATGCAATGTTAAAAACAATACCTAGTAAAAATGCTGGTTTAATAATTGTTATCGCCTCTTTACAATTATTATT
TTTATTAGCAGAACAAAGAAATTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATATTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATAGGATGCCAATTACCTCAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCACTTGTTCATTACAAAAGAACACATTATGATTAC
>gi|90186561|Plasmodium vinckei lentum strain 408XZ cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGATTCCTATTAGGAATTATATTCTTTATTCAAATTTTAACAGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATATCTTATGCATATTATAGTATTCAACATATTCTAAGAGAATTATGGAGTGGATGGTGTTTTAGATATATGCATG
CTACTGGAGCATCTCTTGTATTTTTCTTAACTTATTTACACATCCTAAGAGGATTAAATTATTCATATTTATATTTACCT
TTATCATGGATATCAGGATTAATTATTTTTGCATTATTTATAGTTACTGCTTTTATTGGTTATGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCCACTGTTATAACTAATTTATTATCAGGTATTCCATCATTAGTCATTTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACAATAAAAAGATTTTTTGTTTTACATTTTATACTACCATTTGTTACTTTATGTATAGTATTT
ATACATATATTCTTCTTACATTTACGCGGTAGCACTAATCCTTTAGGGTATGATACATCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCAGATAATGCAATAATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTTTATGCAATGTTAAAAACAATACCTAGTAAAAATGCTGGTTTAATAATTGTTATCGCCTCTTTACAATTATTATT
TTTATTAGCAGAACAAAGAAATTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATATTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATAGGATGCCAATTACCTCAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCACTTGTTCATTACAAAAGA
>gi|90186553|Plasmodium vinckei strain EL cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGGTTCCTACTAGGTATTATATTTTTTATTCAAATTTTAACAGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATCTCTTATGCATATTATAGTATTCAACATATATTAAGAGAATTATGGAGTGGATGGTGTTTTAGATACATGCATG
CTACAGGAGCATCACTTGTATTTTTCTTAACTTATCTACATATTCTAAGAGGGTTAAATTATTCATATTTATATTTACCT
TTATCATGGATATCAGGATTAATTATTTTTGCATTATTTATAGTTACTGCTTTTATTGGTTATGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCAACTGTTATTACTAATTTACTATCTGGTATTCCATCATTAGTTATTTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACTATTAAAAGATTTTTTGTTTTACATTTTATATTACCATTTGTTGCTTTATGTATTGTATTT
ATACATATATTCTTCTTACATTTACATGGTAGCACTAATCCTTTAGGGTATGATCCAGCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCTGATAATGCAATAATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTCTATGCAATGTTAAAAACAATTCCTAGTAAAAATGCTGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
CTTATTAGCAGAACAAAGAAATTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATACTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATAGGATGTCAATTACCTCAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCACTTGTTCATTATAAAAGAACACATTATGATTAC
>gi|90186557|Plasmodium vinckei brucechwatti cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGATTCCTATTAGGAATAATATTTTTTATCCAAATTTTAACTGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATATCTTATGCATATTATAGCATTCAACATATTCTAAGAGAATTATGGAGTGGATGGTGTTTCAGATATATGCATG
CAACTGGTGCATCACTTGTATTTTTCTTAACTTATCTTCATATTTTAAGAGGATTAAATTATTCATATTTATATCTACCT
TTATCATGGATATCAGGATTGATTATTTTTGCATTATTTATAGTTACTGCATTCATAGGTTATGTTTTACCATGGGGACA
AATGAGTTACTGGGGTGCAACTGTTATTACTAATTTACTATCTGGTATACCATCATTAGTTATCTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACAATTAAAAGATTTTTTGTTTTACACTTTATATTACCATTTGTTGCTTTATGTATTGTATTC
ATACATATTTTCTTCTTACATTTACATGGTAGCACTAATCCTTTAGGGTATGATACAGCATTAAAAATACCCTTCTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCAGATAATGCAATTATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTTTATGCAATGTTAAAAACAATTCCAAGTAAAAATGCTGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
TTTATTAGCAGAACAAAGAAACTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATATTCTGTACCTA
TTATATGGTTTATGTGCTCATTCTATGCTTTATTATGGATAGGATGTCAATTACCTCAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTTTCACTTGTTC
>gi|90186565|Plasmodium vinckei petteri strain CR cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGATTCCTACTAGGTATTATATTTTTTATTCAAATTTTAACAGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATATCTTATGCATATTATAGTATTCAACATATATTAAGAGAATTATGGAGTGGATGGTGTTTTAGATACATGCATG
CTACAGGAGCATCACTTGTATTTTTCTTAACTTATCTACATATTCTAAGAGGGTTAAATTATTCATATTTATATTTACCT
TTATCATGGATATCAGGATTAATTATTTTTGCATTATTTATAGTTACTGCTTTTATTGGTTACGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCAACTGTTATTACTAATTTACTATCTGGTATTCCATCATTAGTTATTTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACTATTAAAAGATTTTTTGTTTTACATTTTATATTACCATTTGTTGCTTTATGTATTGTATTT
ATACATATATTCTTCTTACATTTACATGGTAGCACTAATCCTTTAGGGTATGATACAGCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCTGATAATGCAATAATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTCTATGCAATGTTAAAAACAATTCCTAGTAAAAATGCTGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
CTTATTAGCAGAACAAAGAAATTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAGTACTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATAGGATGTCAATTACCTCATGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCCCTTGTTCATTATAAAAGAACACATTATGATTAC
>gi|90186563|Plasmodium vinckei petteri strain BS cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTATGGATTCCTACTAGGTATTATATTTTTTATTCAAATTTTAACAGGTGTATTTTTAGCAAGTCGTTATTCTCC
AGAAATATCTTATGCATATTATAGTATTCAACATATATTAAGAGAATTATGGAGTGGATGGTGTTTTAGATACATGCATG
CTACAGGAGCATCACTTGTATTTTTCTTAACTTATCTACATATTCTAAGAGGGTTAAATTATTCATATTTATATTTACCT
TTATCATGGATATCAGGATTAATTATTTTTGCATTATTTATAGTTACTGCTTTTATTGGTTACGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCAACTGTTATTACTAATTTACTATCTGGTATTCCATCATTAGTTATTTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACTATTAAAAGATTTTTTGTTTTACATTTTATATTACCATTTGTTGCTTTATGTATTGTATTT
ATACATATATTCTTCTTACATTTACATGGTAGCACTAATCCTTTAGGGTATGATACAGCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTTTTAATACAAAGTATTTTTGGTGTAATAC
CATTATCACATCCTGATAATGCAATAATAGTAAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTCTATGCAATGTTAAAAACAATTCCTAGTAAAAATGCTGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
CTTATTAGCAGAACAAAGAAATTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAGTACTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATAGGATGTCAATTACCTCAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCCCTTGTTCATTATAAAAGAACACATTATGATTAC
>gi|90186555|Plasmodium vinckei vinckei strain VIBA Cy Pl cytochrome b (cytb) gene, partial cds; mitochondrial.
TGGAATTACGGATTCCTATTAGGTATTATATTTTTTATTCAAATTTTAACAGGTGTATTCTTAGCAAGTCGTTACTCTCC
AGAAATATCTTATGCATATTATAGTATACAACATATTCTAAGAGAATTATGGAGTGGATGGTGTTTTAGATACATGCATG
CTACAGGAGCATCACTTGTATTTTTCTTAACTTATCTTCATATATTAAGAGGATTAAATTATTCATATTTATATTTACCA
CTATCATGGATATCAGGATTGATTATTTTTGCATTATTTATAGTTACCGCATTTATAGGTTATGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCAACTGTTATTACTAATTTATTATCAGGTATTCCCTCATTAGTTATCTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACAATTAAAAGATTTTTTGTTTTACATTTTATATTACCATTCGTTGCTTTATGTATTGTATTT
ATACATATTTTCTTCTTACATTTACTCGGAAGCACAAATCCTTTAGGGTATGATACAGCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTCCTAATTCAAAGTATTTTTGGAGTAATAC
CATTATCACATCCAGATAATGCAATTATAGTTAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTTTATGCAATGTTAAAAACAATTCCTAGTAAAAATGCAGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
TCTATTAGCAGAACAAAGAAACTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATATTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTACTATGGATAGGATGTCAATTACCACAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTTCTCTAGTGGTTTATTCTCACTTGTTCATTATAAAAGAACACATTATGATTAC
>gi|22651641|Plasmodium vinckei clone VIBA CyO cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product.
TGGAATTACGGATTCCTATTAGGTATTATATTTTTTATTCAAATTTTAACAGGTGTATTCTTAGCAAGTCGTTACTCTCC
AGAAATATCTTATGCATATTATAGTATNCAACATATTCTAAGAGAATTATGGAGTGGATGGTGTTTTAGATACATGCATG
CTACAGGAGCATCACTTGTATTTTTCTTAACTTATCTTCATATATTAAGAGGATTAAATTATTCATATTTATATTTACCA
CTATCATGGATATCAGGATTGATTATTTTTGCATTATTTATAGTTACCGCATTTATAGGTTATGTTTTACCTTGGGGACA
AATGAGTTATTGGGGTGCAACTGTTATTACTAATTTATTATCAGGTATTCCCTCATTAGTTATCTGGTTATGTGGAGGAT
ACACAGTTAGTGATCCAACAATTAAAAGATTTTTTGTTTTACATTTTATATTACCATTCGTTGCTTTATGTATTGTATTT
ATACATATTTTCTTCTTACATTTACTCGGAGGCACTAATCCTTTAGGGTATGATACAGCATTAAAAATACCCTTTTATCC
AAATCTATTAAGTCTTGATGTAAAAGGATTTAATAATATATTAATATTATTCCTAATTCAAAGTATTTTTGGAGTAATAC
CATTATCACATCCAGATAATGCAATTATAGTTAATACATATGTTACACCATTACAAATAGTTCCAGAATGGTATTTCTTA
CCATTTTATGCAATGTTAAAAACAATTCCTAGTAAAAATGCAGGTTTAGTAATTGTTGTCGCATCTTTACAATTATTATT
TCTATTAGCAGAACAAAGAAACTTAACAACTATTATACAATTTAAAATGGTTTTTAGTGCTAGAGAATATTCTGTTCCTA
TTATATGGTTTATGTGTTCATTCTATGCTTTACTATGGATAGGATGTCAATTACCACAAGATATATTCATTTTATATGGT
AGATTATTTATAATATTATTTTATCGTCCTAGTGGA