>gi|89574297|Plasmodium vinckei lentum isolate 194ZZ caseinolytic protease C gene, partial cds; apicoplast.
AATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGTTATTCAGAAGGTGGTCAATTA
ACTGAACAAGTATATAATAAACCAAACTGTGTTATTTTATTTGATGAAATAGAAAAAGCACACCCTGATATTTATAATAT
AATGCTACAAATATTAGATGAAGGTAGATTAACAGACACTACTGGTAAATTAATTGATTTTACAAACACAATAATTTTAT
TAACAAGTAACTTAGGATGTCCTACAAATTATGATAAATATTTAAATAATAAAAATTATTTAAATGAGTTTGATTTAAAA
GATATAAAAAATAATATAAAAAATAAAATAACTAATTATTTTAAACCTGAATTATTAAATAGGCTAACAAATATATTAAT
ATTTAATCCTTTAAATATAAAATCTTTAAATTTAATTTTTAATAAATTTATAACAGAATTAAAAACAAAATTATATTTAA
ATAAATTAAATATTATTATAT
>gi|89574299|Plasmodium vinckei lentum isolate 408XZ caseinolytic protease C gene, partial cds; apicoplast.
TAGATTTGATATGAGTGAATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGTTATT
CAGAAGGAGGTCAATTAACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATTTGATGAAATAGAAAAAGCACAC
CCTGATATTTATAATATAATGCTACAAATATTAGATGAAGGTAGATTAACAGACACTACTGGTAAATTAATTGATTTTAC
AAATACAATAATATTATTAACAAGTAATTTAGGATGTCCTACAAATTATGATAAATATTTACATAATAAAAATTATTTAA
ATGAGTTTGATTTAAAAGATATAAAAAATAATATAAAAAATAAAATAACTAATTATTTTAAACCTGAATTATTAAACAGA
TTAACAAATATATTAATATTTAATCCTTTAAATATAAAATCATTAAATTTAATTTTTAATAAATTTATAACAGAATTAAA
AACAAAATTATATTTAAATAAATTAAATATTA
>gi|89574291|Plasmodium vinckei isolate EL caseinolytic protease C gene, partial cds; apicoplast.
AATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGTTATTCAGAAGGAGGTCAATTA
ACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATTTGATGAAATAGAAAAAGCACACCCTGATATTTATAATAT
AATGCTACAAATATTAGATGAAGGTAGATTAACAGACACTACTGGTAAATTAATTGATTTTACAAATACAATAATTTTAT
TAACAAGTAATTTAGGATGTCCTACAAATTATGATAAATATTTACATAATAAAAATTATTTAAATGAGTTTGATTTAAAA
GATATAAAAAATAATATAAAAAATAAAATAACTAATTATTTTAAACCTGAATTATTAAACAGGCTAACAAATATATTAAT
ATTTAATCCTTTAAATATAAAATCATTAAATTTAATTTTTAATAAATTTATAACAGAATTAAAAACAAAATTATATTTAA
ATAAATTAAATATTATTATAT
>gi|89574295|Plasmodium vinckei brucechwatti caseinolytic protease C gene, partial cds; apicoplast.
ATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGTTATTCAGAAGGTGGTCAATTAA
CAGAACAAGTATATAATAAACCAAACTGTGTTATTTTATTTGATGAAATAGAAAAAGCACACCCTGATATTTATAATATA
ATGCTACAAATATTAGATGAAGGTAGATTAACAGACACTACTGGTAAATTAATTGATTTTACAAACACAATAATTTTATT
AACAAGTAACTTAGGATGTCCTACAAATTATGATAAATATTTAAATAATAAAAATTATTTAAATGAGTTTGATTTAAAAG
ATATAAAAAATAATATAAAAAATAAAATAACTAATTATTTTAAACCTGAATTATTAAATAGACTAACAAATATATTAATA
TTTAATCCTTTAAATATAAAATCTTTAAATTTAATTTTTAATAAATTTATAACAGAATTAAAAACAAAATTATATTTAAA
TAAATTAAATATTATTATAT
>gi|89574303|Plasmodium vinckei petteri isolate CR caseinolytic protease C gene, partial cds; apicoplast.
ATAAGATTTGATATGAGTGAATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGTTA
TTCAGAAGGTGGTCAATTAACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATTTGATGAAATAGAAAAAGCAC
ATCCTGATATATATAATATAATGTTACAAATATTAGATGAAGGTAGATTAACTGATACTACTGGTAAATTAATTGATTTT
ACAAATACAATAATTTTATTAACAAGTAATTTAGGATGTCCAACAAATTATGATAAATATTTAAATAATAAAAATTATTT
AAATGAATTAGATTTAAAAGATATAAAAAATAATATTAAAAGTAAAATATCTAATTATTTTAAACCTGAATTATTAAATA
GATTAACAAATATATTAATATTTAATCCATTAAATATCAAATCATTAAATTTAATTTTTAATAAATTTATAACAGAATTA
AAGACAAAATTATATTTAAATAAATTAAATATTATTATAT
>gi|89574301|Plasmodium vinckei petteri isolate BS caseinolytic protease C gene, partial cds; apicoplast.
TTATTAGATGTGATATGAGTGAATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTTATATAGGT
TACTCAGAAGGAGGTCAATTAACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATTTGATGAAATAGAAAAAGC
ACATCCTGATATTTATAATATAATGTTACAAATATTAGACGAAGGTAGATTAACAGATACTACTGGTAAATTAATTGATT
TTACAAATACAATAATTTTATTAACAAGTAACTTAGGATGTCCTACAAATTATGATAAATATTTAAATAATAAAAATTAT
TTAAATGAATTAGATTTAAAAGATATAAAAAATAATATTAAAACTAAAATAACTAATTATTTTAAACCTGAATTATTAAA
TAGATTAACAAACATATTAATATTTAATCCTTTAAATATAAAAGCATTAAATTTAATTTTTAATAAATTTATAACAGAAT
TAAAAACAAAATTATATTTAAATAAATTAAATATTATTATAT
>gi|89574293|Plasmodium vinckei vinckei isolate VIBA Cy Pl caseinolytic protease C gene, partial cds; apicoplast.
AAACGAATTAATTAGATTTGATATGAGTGAATATATGGAAAAACATTCTATTTCTAGATTAATAGGTTCACCTCCAGGTT
ATATTGGTTACTCAGAAGGAGGTCAATTAACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATTTGATGAAATA
GAAAAAGCACATCCTGATATTTATAATATAATGTTACAAATATTAGACGAAGGTAGATTAACAGATACTACTGGTAAATT
AATTGATTTTACAAATACAATAATTTTATTAACAAGTAACTTAGGATGTCCTACAAATTATGATAAATATTTAAATAATA
AAAATTATTTAAATGAATTAGATTTAAAAGATATAAAAAATAATATTAAAACTAAAATAACTAATTATTTTAAACCTGAA
TTATTAAATAGATTAACAAACATATTAATATTTAATCCTTTAAATATAAAAGCATTAAATTTAATTTTTAATAAATTTAT
AACAGAATTAAAAACAAAATTATATTTAAACAAATTAAATATTATTATAT
>gi|169136001|Plasmodium vinckei strain R8 caseinolytic protease C (clpc) gene, partial cds; apicoplast.
CCTCCAGGTTATATTGGTTACTCAGAAGGAGGTCAATTAACAGAACAAGTATATAATAAACCAAATTGTGTTATTTTATT
TGATGAAATAGAAAAAGCACATCCTGATATTTATAATATAATGTTACAAATATTAGACGAAGGTAGATTAACAGATACTA
CTGGTAAATTAATTGATTTTACAAATACAATAATTTTATTAACAAGTAACTTAGGATGTCCTACAAATTATGATAAATAT
TTAAATAATAAAAATTATTTAAATGAATTAGATTTAAAAGATATAAAAAATAATATTAAAACTAAAATAACTAATTATTT
TAAACCTGAATTATTAAATAGATTAACAAACATATTAATATTTAATCCTTTAAATATAAAAGCATTAAATTTAATTTTTA
ATAAATTTATAACAGAATTAAAAACAAAATTATATTTAAACAAATTAAATATTATTATATCTATTAATAATAACTTAAAA
TATTTCATAATTAAATTAA